Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6221813
End position: 6221836
Length: 24

DNA sequence
>NC_022785, from 6221813 to 6221836 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGCCGGGGCGGGTGCCGGGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6221314-6222294	Sequence	M271_25195 - membrane protein (Protein is coded in complementary strand; from 6222294 to 6221314)