Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6167308
End position: 6167352
Length: 45

DNA sequence
>NC_022785, from 6167308 to 6167352 (45 bp); Streptomyces rapamycinicus NRRL 5491 CGGCTCCGGTCCCGTCGGCTCCCGTTCCGCCGGTTCCGGCTCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6166520-6167362	Sequence	M271_24925 - membrane protein (Protein is coded in complementary strand; from 6167362 to 6166520)