Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6155344
End position: 6155370
Length: 27

DNA sequence
>NC_022785, from 6155344 to 6155370 (27 bp); Streptomyces rapamycinicus NRRL 5491 GTTGCCCATGTTGCCCATGTTGCCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6153608-6155602	Sequence	M271_24870 - hypothetical protein (Protein is coded in complementary strand; from 6155602 to 6153608)