Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6146406
End position: 6146432
Length: 27

DNA sequence
>NC_022785, from 6146406 to 6146432 (27 bp); Streptomyces rapamycinicus NRRL 5491 ACCGCGATCACCGCGAGCACCGCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6145998-6147437	Sequence	M271_24840 - Ser/Thr protein kinase (Protein is coded in complementary strand; from 6147437 to 6145998)