Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6111099
End position: 6111134
Length: 36

DNA sequence
>NC_022785, from 6111099 to 6111134 (36 bp); Streptomyces rapamycinicus NRRL 5491 GGCGTACCGGTGGGAGTGCCGGTGGGAGTGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6110646-6111593	Sequence	M271_24720 - dioxygenase (Protein is coded in complementary strand; from 6111593 to 6110646)