Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6089117
End position: 6089140
Length: 24

DNA sequence
>NC_022785, from 6089117 to 6089140 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGTCGGGGTCGGCGTTGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6088864-6090162	Sequence	M271_24640 - cytochrome P450 (Protein is coded in complementary strand; from 6090162 to 6088864)