Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6071911
End position: 6071937
Length: 27

DNA sequence
>NC_022785, from 6071911 to 6071937 (27 bp); Streptomyces rapamycinicus NRRL 5491 GCCGTCACGGCCGTCACGGCCATCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6071855-6072202	Sequence	M271_24545 - hypothetical protein (Protein is coded in complementary strand; from 6072202 to 6071855)