Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6070465
End position: 6070491
Length: 27

DNA sequence
>NC_022785, from 6070465 to 6070491 (27 bp); Streptomyces rapamycinicus NRRL 5491 TCCGCCAGCTCCGCCAGTTCCCCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6070405-6071829	Sequence	M271_24540 - oxidoreductase (Protein is coded in complementary strand; from 6071829 to 6070405)