Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6060704
End position: 6060730
Length: 27

DNA sequence
>NC_022785, from 6060704 to 6060730 (27 bp); Streptomyces rapamycinicus NRRL 5491 CGCCCACCGCGCCCACCGCGCCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6060644-6061627	Sequence	M271_24485 - phenazine biosynthesis protein PhzF