Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6048280
End position: 6048312
Length: 33

DNA sequence
>NC_022785, from 6048280 to 6048312 (33 bp); Streptomyces rapamycinicus NRRL 5491 GCGTCATGGCTGCGTCATGGCTGCGTCATGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6048306-6048749	Sequence	M271_24425 - ketosteroid isomerase (Protein is coded in complementary strand; from 6048749 to 6048306)