Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6036164
End position: 6036208
Length: 45

DNA sequence
>NC_022785, from 6036164 to 6036208 (45 bp); Streptomyces rapamycinicus NRRL 5491 GCGGCGGTGTCTGTGTCTGCCGTGTCTGTGTCTGCCGTGTCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6035350-6036561	Sequence	M271_24355 - hypothetical protein (Protein is coded in complementary strand; from 6036561 to 6035350)