Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6020772
End position: 6020795
Length: 24

DNA sequence
>NC_022785, from 6020772 to 6020795 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCTGCACCTGCACCTGCACCTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6020660-6020869	Sequence	M271_24280 - hypothetical protein (Protein is coded in complementary strand; from 6020869 to 6020660)