Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6020770
End position: 6020799
Length: 30

DNA sequence
>NC_022785, from 6020770 to 6020799 (30 bp); Streptomyces rapamycinicus NRRL 5491 CGCCTGCACCTGCACCTGCACCTGCACCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6020660-6020869	Sequence	M271_24280 - hypothetical protein (Protein is coded in complementary strand; from 6020869 to 6020660)