Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5971674
End position: 5971697
Length: 24

DNA sequence
>NC_022785, from 5971674 to 5971697 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGCCGGGGCCAGGGTCGGGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5971417-5972109	Sequence	M271_24010 - SpdA protein (Protein is coded in complementary strand; from 5972109 to 5971417)