Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5964236
End position: 5964283
Length: 48

DNA sequence
>NC_022785, from 5964236 to 5964283 (48 bp); Streptomyces rapamycinicus NRRL 5491 CGGCCGGAGCCGCCGCCGGGGCCGGAGCCGGAGCCGGGGCCGGAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5961470-5964319	Sequence	M271_23980 - histidine kinase (Protein is coded in complementary strand; from 5964319 to 5961470)