Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5939126
End position: 5939149
Length: 24

DNA sequence
>NC_022785, from 5939126 to 5939149 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCGCCGCAGCCACCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5939051-5939347	Sequence	M271_23870 - hypothetical protein (Protein is coded in complementary strand; from 5939347 to 5939051)