Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5925258
End position: 5925293
Length: 36

DNA sequence
>NC_022785, from 5925258 to 5925293 (36 bp); Streptomyces rapamycinicus NRRL 5491 GCCCCGGCGCCTGGCCCGGCGCCTGGCCCGACGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5925215-5926606	Sequence	M271_23810 - ATPase (Protein is coded in complementary strand; from 5926606 to 5925215)