Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5923104
End position: 5923145
Length: 42

DNA sequence
>NC_022785, from 5923104 to 5923145 (42 bp); Streptomyces rapamycinicus NRRL 5491 GCTCCGCGCTCAGGTCTCCGCACTCAGGTCTCCGCGCTCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5923142-5924365	Sequence	M271_23800 - cytochrome P450 (Protein is coded in complementary strand; from 5924365 to 5923142)