Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5908493
End position: 5908528
Length: 36

DNA sequence
>NC_022785, from 5908493 to 5908528 (36 bp); Streptomyces rapamycinicus NRRL 5491 ACGGCGGTCGGCCCGGCGGACGGCCCGGCGGTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5908525-5909175	Sequence	M271_23750 - hypothetical protein (Protein is coded in complementary strand; from 5909175 to 5908525)