Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5906012
End position: 5906050
Length: 39

DNA sequence
>NC_022785, from 5906012 to 5906050 (39 bp); Streptomyces rapamycinicus NRRL 5491 CGAACCCGCTGCACGAACCCGCTCTACGAACCCGCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5906036-5907301	Sequence	M271_23740 - phosphoribosylamine--glycine ligase (Protein is coded in complementary strand; from 5907301 to 5906036)