Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5893551
End position: 5893586
Length: 36

DNA sequence
>NC_022785, from 5893551 to 5893586 (36 bp); Streptomyces rapamycinicus NRRL 5491 GGTTCTCGGGCCGGTCCTCAGGCCGGTCCTCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5893581-5895830	Sequence	M271_23675 - phosphoribosylglycinamide synthetase (Protein is coded in complementary strand; from 5895830 to 5893581)