Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5771751
End position: 5771777
Length: 27

DNA sequence
>NC_022785, from 5771751 to 5771777 (27 bp); Streptomyces rapamycinicus NRRL 5491 GTCCGTGCCGTCCATGCCGTCCATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5769694-5773689	Sequence	M271_23045 - LuxR family transcriptional regulator (Protein is coded in complementary strand; from 5773689 to 5769694)