Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5766235
End position: 5766279
Length: 45

DNA sequence
>NC_022785, from 5766235 to 5766279 (45 bp); Streptomyces rapamycinicus NRRL 5491 CGAGCCGTCCACCGGCGTCCCGTCCACGGGCGTTCCGTCCACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5764937-5766916	Sequence	M271_23030 - Ser/Thr protein phosphatase (Protein is coded in complementary strand; from 5766916 to 5764937)