Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5707311
End position: 5707346
Length: 36

DNA sequence
>NC_022785, from 5707311 to 5707346 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCGCGGAGCCCGCGGAGCCCGCAGAGCCCGCAGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5707277-5708116	Sequence	M271_22760 - transcriptional regulator (Protein is coded in complementary strand; from 5708116 to 5707277)