Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5703851
End position: 5703874
Length: 24

DNA sequence
>NC_022785, from 5703851 to 5703874 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCCTGCCCCTGCCCCTGCCCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5703536-5704675	Sequence	M271_22740 - protease (Protein is coded in complementary strand; from 5704675 to 5703536)