Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5686809
End position: 5686853
Length: 45

DNA sequence
>NC_022785, from 5686809 to 5686853 (45 bp); Streptomyces rapamycinicus NRRL 5491 TCAGACCCTGACGCCTCAGACCTTGACGCCTCAGACCTTGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5686840-5687394	Sequence	M271_22670 - peptidase (Protein is coded in complementary strand; from 5687394 to 5686840)