Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5607239
End position: 5607283
Length: 45

DNA sequence
>NC_022785, from 5607239 to 5607283 (45 bp); Streptomyces rapamycinicus NRRL 5491 GCTGTCCTCCTTACGGCTGTCCTCCTTGCGGCTGTCCTCCTTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5606490-5607827	Sequence	M271_22350 - hypothetical protein (Protein is coded in complementary strand; from 5607827 to 5606490)