Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5605647
End position: 5605700
Length: 54

DNA sequence
>NC_022785, from 5605647 to 5605700 (54 bp); Streptomyces rapamycinicus NRRL 5491 TTCTCGGGGTGGTCGGAGTTCCCCGGGTGGTCGGAATCCTCCGGGCGGTCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5605638-5606081	Sequence	M271_22340 - hypothetical protein (Protein is coded in complementary strand; from 5606081 to 5605638)