Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5534148
End position: 5534192
Length: 45

DNA sequence
>NC_022785, from 5534148 to 5534192 (45 bp); Streptomyces rapamycinicus NRRL 5491 CTCATCAGCCCGCGACTCATCAGCCCGCGACTCATCAGCCCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5534183-5535166	Sequence	M271_22020 - multidrug ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 5535166 to 5534183)