Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5512172
End position: 5512198
Length: 27

DNA sequence
>NC_022785, from 5512172 to 5512198 (27 bp); Streptomyces rapamycinicus NRRL 5491 CGGCGAGGGCGGCCAGGGCGGCGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5510713-5512272	Sequence	M271_21925 - NADH-quinone oxidoreductase subunit N (Protein is coded in complementary strand; from 5512272 to 5510713)