Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5485686
End position: 5485709
Length: 24

DNA sequence
>NC_022785, from 5485686 to 5485709 (24 bp); Streptomyces rapamycinicus NRRL 5491 AGCGCCAGCCCCAGGGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5485641-5486459	Sequence	M271_21785 - membrane protein (Protein is coded in complementary strand; from 5486459 to 5485641)