Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5475707
End position: 5475730
Length: 24

DNA sequence
>NC_022785, from 5475707 to 5475730 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCTCAGCCTCAGCCTCGGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5475091-5475933	Sequence	M271_21715 - transcription antitermination protein NusG (Protein is coded in complementary strand; from 5475933 to 5475091)