Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5456239
End position: 5456292
Length: 54

DNA sequence
>NC_022785, from 5456239 to 5456292 (54 bp); Streptomyces rapamycinicus NRRL 5491 CGAGGGTCGGGGTCAGTGCGAGGGTCGGGGTCAGTGCGAGGGTCGGAGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5454892-5458116	Sequence	M271_21655 - hypothetical protein (Protein is coded in complementary strand; from 5458116 to 5454892)