Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5445943
End position: 5446002
Length: 60

DNA sequence
>NC_022785, from 5445943 to 5446002 (60 bp); Streptomyces rapamycinicus NRRL 5491 GGTCGCTTGCGGGGGCGCCTGCGGGGTCGCTTGCGGGGGCGCCTGCGGGGTCGCCTGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5443851-5452397	Sequence	M271_21640 - hypothetical protein (Protein is coded in complementary strand; from 5452397 to 5443851)