Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5435961
End position: 5435984
Length: 24

DNA sequence
>NC_022785, from 5435961 to 5435984 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCGGAGCCGGAGCCGGAGCCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5435715-5437112	Sequence	M271_21635 - hypothetical protein (Protein is coded in complementary strand; from 5437112 to 5435715)