Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5420052
End position: 5420114
Length: 63

DNA sequence
>NC_022785, from 5420052 to 5420114 (63 bp); Streptomyces rapamycinicus NRRL 5491 CTCGACGGGCAGGGGCAGCGCCTCGACGGGCAGGGCCAGGGCCTCGACGGGCAGGGCCAGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5416365-5424318	Sequence	M271_21620 - hypothetical protein (Protein is coded in complementary strand; from 5424318 to 5416365)