Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5402998
End position: 5403033
Length: 36

DNA sequence
>NC_022785, from 5402998 to 5403033 (36 bp); Streptomyces rapamycinicus NRRL 5491 GTCTCGGATGCGGTCGTGGATGCGGTCGCGGAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5401312-5404821	Sequence	M271_21610 - hypothetical protein (Protein is coded in complementary strand; from 5404821 to 5401312)