Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5397275
End position: 5397298
Length: 24

DNA sequence
>NC_022785, from 5397275 to 5397298 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCGTCCGCGTCCGCGTCCGCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5392611-5399027	Sequence	M271_21600 - hypothetical protein (Protein is coded in complementary strand; from 5399027 to 5392611)