Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5363203
End position: 5363226
Length: 24

DNA sequence
>NC_022785, from 5363203 to 5363226 (24 bp); Streptomyces rapamycinicus NRRL 5491 TCCTCGCCCTCGTCTTCGTCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5362939-5363526	Sequence	M271_21530 - hypothetical protein (Protein is coded in complementary strand; from 5363526 to 5362939)