Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5325623
End position: 5325646
Length: 24

DNA sequence
>NC_022785, from 5325623 to 5325646 (24 bp); Streptomyces rapamycinicus NRRL 5491 TCGGCCTCGGCGACGGCCGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5325476-5326834	Sequence	M271_21270 - phosphoglucosamine mutase (Protein is coded in complementary strand; from 5326834 to 5325476)