Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5305640
End position: 5305666
Length: 27

DNA sequence
>NC_022785, from 5305640 to 5305666 (27 bp); Streptomyces rapamycinicus NRRL 5491 GGACTCGCCGGGCTCGCCGGGCTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5305545-5306186	Sequence	M271_21170 - hypothetical protein (Protein is coded in complementary strand; from 5306186 to 5305545)