Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5304475
End position: 5304498
Length: 24

DNA sequence
>NC_022785, from 5304475 to 5304498 (24 bp); Streptomyces rapamycinicus NRRL 5491 GTGGGAGTGGGAGTTGGAGTGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5304434-5305552	Sequence	M271_21165 - O-sialoglycoprotein endopeptidase (Protein is coded in complementary strand; from 5305552 to 5304434)