Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5292235
End position: 5292279
Length: 45

DNA sequence
>NC_022785, from 5292235 to 5292279 (45 bp); Streptomyces rapamycinicus NRRL 5491 GCAGAAGCCGTCGTCGGAGAGGCCGTCCTCGGAGAAGCCGTAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5291856-5292278	Sequence	M271_21110 - hypothetical protein
ORF. 5292227-5292940	Sequence	M271_21115 - hypothetical protein (Protein is coded in complementary strand; from 5292940 to 5292227)