Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5262851
End position: 5262886
Length: 36

DNA sequence
>NC_022785, from 5262851 to 5262886 (36 bp); Streptomyces rapamycinicus NRRL 5491 TCGCGCCGGACTTCGCACCGGACTTCGCGCCGGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5261947-5263947	Sequence	M271_20990 - serine/threonine protein kinase (Protein is coded in complementary strand; from 5263947 to 5261947)