Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5253499
End position: 5253522
Length: 24

DNA sequence
>NC_022785, from 5253499 to 5253522 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCCGCCCCCGGCACCGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5253194-5253745	Sequence	M271_20960 - regulatory protein (Protein is coded in complementary strand; from 5253745 to 5253194)