Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5249780
End position: 5249824
Length: 45

DNA sequence
>NC_022785, from 5249780 to 5249824 (45 bp); Streptomyces rapamycinicus NRRL 5491 CTGCGGTCCGGAGTGCTGGGGATCGGAGTGCTGCGGGCCGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5249520-5250914	Sequence	M271_20945 - acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 5250914 to 5249520)