Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5207197
End position: 5207250
Length: 54

DNA sequence
>NC_022785, from 5207197 to 5207250 (54 bp); Streptomyces rapamycinicus NRRL 5491 CGGAGGCGGTGGGTCCGGCGGAGGCGGTGGGTCCGGCGGAGGCGGTGGGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5206428-5207318	Sequence	M271_20780 - hypothetical protein (Protein is coded in complementary strand; from 5207318 to 5206428)