Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5194333
End position: 5194400
Length: 68

DNA sequence
>NC_022785, from 5194333 to 5194400 (68 bp); Streptomyces rapamycinicus NRRL 5491 GCGCACCGTCTATTGGGGCGCGCCGTCTATTGGGGCGCACCCTCCATCGGGGCGCACGGTCTATTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5194394-5194981	Sequence	M271_20745 - hypothetical protein (Protein is coded in complementary strand; from 5194981 to 5194394)