Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5171086
End position: 5171121
Length: 36

DNA sequence
>NC_022785, from 5171086 to 5171121 (36 bp); Streptomyces rapamycinicus NRRL 5491 GCGGCGGAACCGGCGGAAGCGGCGGAACCGGCGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5170276-5172300	Sequence	M271_20670 - tetracycline resistance protein tetM