Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 5133108
End position: 5133134
Length: 27

DNA sequence
>NC_022785, from 5133108 to 5133134 (27 bp); Streptomyces rapamycinicus NRRL 5491 GCCAGCGCCGCCAGGGCCGCCAGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5131635-5133488	Sequence	M271_20480 - ROK family transcriptional regulator (Protein is coded in complementary strand; from 5133488 to 5131635)